Orthologous regulated operons containing Csal_2644 gene
| Regulog: | PsrA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -36
Score: 4.99905 Sequence: ATTCACACATACGTTTGCAT
Locus tag: Csal_2644
Name: null Funciton: acyl-CoA dehydrogenase-like protein |
||||
| Csal_2644 | -36 | 5 | ATTCACACATACGTTTGCAT | Csal_2644 |