Orthologous regulated operons containing fadL gene
| Regulog: | PsrA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -132
Score: 5.0196 Sequence: ATTAAAACAAACGTTTGCTC
Locus tag: Csal_3004
Name: fadL Funciton: Long-chain fatty acid transport protein |
||||
| fadL | -132 | 5 | ATTAAAACAAACGTTTGCTC | Csal_3004 |