Orthologous regulated operons containing fadE gene
| Regulog: | PsrA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -39
Score: 5.58356 Sequence: ATTCAAACGCTCGTTAGAAT
Locus tag: Csal_1510
Name: fadE Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| fadE | -39 | 5.6 | ATTCAAACGCTCGTTAGAAT | Csal_1510 |