Orthologous regulated operons containing acdH4 gene
| Regulog: | PsrA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alcanivorax borkumensis SK2 | ||||
|
Position: -138
Score: 5.71062 Sequence: TTTCAAACGCTTGTTTGACT
Locus tag: ABO_2102
Name: acdH4 Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3) |
||||
| acdH4 | -138 | 5.7 | TTTCAAACGCTTGTTTGACT | ABO_2102 |