Orthologous regulated operons containing MED297_00330 gene
| Regulog: | PsrA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Reinekea sp. MED297 | ||||
|
Position: -67
Score: 5.83947 Sequence: ATTCAAACGCGCGTTTAAAT
Locus tag: MED297_00330
Name: null Funciton: enoyl-CoA hydratase/isomerase family protein |
||||
| MED297_00330 | -67 | 5.8 | ATTCAAACGCGCGTTTAAAT | MED297_00330 |