Orthologous regulated operons containing acdH3 gene
| Regulog: | PsrA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -101
Score: 4.98895 Sequence: AATCAAACGAACGCTTGACT
Position: -61
Score: 5.58832 Sequence: TTTCAAACGCATGTTTGATG
Locus tag: Csal_2431
Name: acdH3 Funciton: acyl-CoA dehydrogenase-like protein |
||||
| acdH3 | -101 | 5 | AATCAAACGAACGCTTGACT | Csal_2431 |
| -61 | 5.6 | TTTCAAACGCATGTTTGATG | ||