Orthologous regulated operons containing Maqu_0515 gene
| Regulog: | PsrA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Marinobacter aqueolei | ||||
|
Position: -91
Score: 5.37482 Sequence: ATTCAAACGCCCGTATGAAG
Locus tag: Maqu_0515
Name: null Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3) |
||||
| Maqu_0515 | -91 | 5.4 | ATTCAAACGCCCGTATGAAG | Maqu_0515 |
| Marinobacter sp. ELB17 | ||||
|
Position: -66
Score: 5.61477 Sequence: ATTAAAACAGTCGTATGAAT
Locus tag: MELB17_18674
Name: null Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3) |
||||
| MELB17_18674 | -66 | 5.6 | ATTAAAACAGTCGTATGAAT | MELB17_18674 |