Orthologous regulated operons containing HCH_05787 gene
| Regulog: | PsrA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Hahella chejuensis KCTC 2396 | ||||
|
Position: -84
Score: 5.00037 Sequence: CATAAAACGACTGTTTCAAA
Position: -71
Score: 5.89939 Sequence: TTTCAAACGAATGTTTTAAA
Locus tag: HCH_05787
Name: null Funciton: hypothetical protein |
||||
| HCH_05787 | -84 | 5 | CATAAAACGACTGTTTCAAA | HCH_05787 |
| -71 | 5.9 | TTTCAAACGAATGTTTTAAA | ||