Orthologous regulated operons containing fadH gene
| Regulog: | PsrA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -61
Score: 5.29259 Sequence: GTTCATACAGTTGTTTGAAA
Locus tag: Csal_0879
Name: fadH Funciton: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34) |
||||
| fadH | -61 | 5.3 | GTTCATACAGTTGTTTGAAA | Csal_0879 |