Orthologous regulated operons containing MED297_20722 gene
| Regulog: | PsrA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Reinekea sp. MED297 | ||||
|
Position: -55
Score: 6.15688 Sequence: ATTCAAACGACCGTTTGAAT
Locus tag: MED297_20722
Name: null Funciton: TesB-like acyl-CoA thioesterase 1 |
||||
| MED297_20722 | -55 | 6.2 | ATTCAAACGACCGTTTGAAT | MED297_20722 |