Orthologous regulated operons containing fadD gene
| Regulog: | PsrA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -249
Score: 5.11499 Sequence: TTTTAATCGTCTGTTTTAAT
Locus tag: Csal_1468
Name: fadD Funciton: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
||||
| fadD | -249 | 5.1 | TTTTAATCGTCTGTTTTAAT | Csal_1468 |
| Reinekea sp. MED297 | ||||
|
Position: -95
Score: 5.66199 Sequence: TATCAAACGACCGTTTTAAT
Locus tag: MED297_17502
Name: fadD Funciton: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
||||
| fadD | -95 | 5.7 | TATCAAACGACCGTTTTAAT | MED297_17502 |