Orthologous regulated operons containing Maqu_1467 gene
| Regulog: | PsrA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Marinobacter aqueolei | ||||
|
Position: -31
Score: 5.49938 Sequence: ATTCATACATTCGTTTGAAC
Locus tag: Maqu_1467
Name: null Funciton: putative saccharopine dehydrogenase |
||||
| Maqu_1467 | -31 | 5.5 | ATTCATACATTCGTTTGAAC | Maqu_1467 |
| Marinobacter sp. ELB17 | ||||
|
Position: -202
Score: 5.43499 Sequence: AAACAAACGTTTGTTTTAAT
Locus tag: MELB17_13682
Name: etfB Funciton: Electron transfer flavoprotein, beta subunit
Locus tag: MELB17_13677
Name: etfA Funciton: Electron transfer flavoprotein, alpha subunit
Locus tag: MELB17_13672
Name: null Funciton: putative saccharopine dehydrogenase |
||||
| etfB-etfA-MELB17_13672 | -202 | 5.4 | AAACAAACGTTTGTTTTAAT | MELB17_13682 |