Orthologous regulated operons containing acdH1 gene
| Regulog: | PsrA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Hahella chejuensis KCTC 2396 | ||||
|
Position: -135
Score: 5.28997 Sequence: AAGCAAACGTATGTTTCAAA
Position: -122
Score: 5.92805 Sequence: TTTCAAACACTTGTTTGATA
Locus tag: HCH_05361
Name: acdH1 Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3) |
||||
| acdH1 | -135 | 5.3 | AAGCAAACGTATGTTTCAAA | HCH_05361 |
| -122 | 5.9 | TTTCAAACACTTGTTTGATA | ||
| Marinobacter aqueolei | ||||
|
Position: -115
Score: 5.8341 Sequence: TTTCAAACGAGTGTTTAATT
Locus tag: Maqu_2750
Name: acdH1 Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3) |
||||
| acdH1 | -115 | 5.8 | TTTCAAACGAGTGTTTAATT | Maqu_2750 |
| Marinobacter sp. ELB17 | ||||
|
Position: -114
Score: 6.0566 Sequence: TTTCAAACAATCGTTTAAAA
Locus tag: MELB17_07014
Name: acdH1 Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3) |
||||
| acdH1 | -114 | 6.1 | TTTCAAACAATCGTTTAAAA | MELB17_07014 |
| Oceanobacter sp. RED65 | ||||
|
Position: -122
Score: 5.4929 Sequence: TTGCAAACGTATGTTTCAAA
Position: -109
Score: 5.82548 Sequence: TTTCAAACACTTGTTTGAAG
Locus tag: RED65_07784
Name: acdH1 Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3) |
||||
| acdH1 | -122 | 5.5 | TTGCAAACGTATGTTTCAAA | RED65_07784 |
| -109 | 5.8 | TTTCAAACACTTGTTTGAAG | ||
| Reinekea sp. MED297 | ||||
|
Position: -122
Score: 6.30705 Sequence: TTTCAAACGATCGTTTGAAT
Locus tag: MED297_12452
Name: acdH1 Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3) |
||||
| acdH1 | -122 | 6.3 | TTTCAAACGATCGTTTGAAT | MED297_12452 |