Orthologous regulated operons containing etfD gene
| Regulog: | PsrA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alcanivorax borkumensis SK2 | ||||
|
Position: -233
Score: 5.36429 Sequence: ATCTAAACACTTGTTTGAAA
Locus tag: ABO_1100
Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
||||
| etfD | -233 | 5.4 | ATCTAAACACTTGTTTGAAA | ABO_1100 |
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -127
Score: 5.70845 Sequence: AATCAAACAACCGTTTAAAA
Locus tag: Csal_1612
Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
||||
| etfD | -127 | 5.7 | AATCAAACAACCGTTTAAAA | Csal_1612 |
| Hahella chejuensis KCTC 2396 | ||||
|
Position: -246
Score: 5.63103 Sequence: ATTCAAACAAACGTTTGTTT
Position: -242
Score: 5.21802 Sequence: AAACAAACGTTTGTTTGAGT
Locus tag: HCH_03954
Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
||||
| etfD | -246 | 5.6 | ATTCAAACAAACGTTTGTTT | HCH_03954 |
| -242 | 5.2 | AAACAAACGTTTGTTTGAGT | ||
| Marinobacter aqueolei | ||||
|
Position: -170
Score: 5.63598 Sequence: TTTCAAACAAACGTTTGTTT
Position: -166
Score: 5.55848 Sequence: AAACAAACGTTTGTTTGATT
Locus tag: Maqu_1472
Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
||||
| etfD | -170 | 5.6 | TTTCAAACAAACGTTTGTTT | Maqu_1472 |
| -166 | 5.6 | AAACAAACGTTTGTTTGATT | ||
| Marinobacter sp. ELB17 | ||||
|
Position: -191
Score: 5.44201 Sequence: ATTAAAACAAACGTTTGTTT
Locus tag: MELB17_13687
Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
||||
| etfD | -191 | 5.4 | ATTAAAACAAACGTTTGTTT | MELB17_13687 |
| Oceanobacter sp. RED65 | ||||
|
Position: -236
Score: 6.02849 Sequence: ATTCAAACGCGCGTTTGAAT
Locus tag: RED65_07029
Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
||||
| etfD | -236 | 6 | ATTCAAACGCGCGTTTGAAT | RED65_07029 |
| Reinekea sp. MED297 | ||||
|
Position: -157
Score: 5.83668 Sequence: TTTCAAACAGTTGTTTTAAT
Locus tag: MED297_16324
Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
||||
| etfD | -157 | 5.8 | TTTCAAACAGTTGTTTTAAT | MED297_16324 |