Orthologous regulated operons containing SO2935 gene
| Regulog: | PsrA - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Colwellia psychrerythraea 34H | ||||
|
Position: -186
Score: 5.09762 Sequence: ATTCAAACTAATGTTTTAAT
Locus tag: CPS_1191
Name: null Funciton: oxidoreductase, short-chain dehydrogenase/reductase family |
||||
| CPS_1191 | -186 | 5.1 | ATTCAAACTAATGTTTTAAT | CPS_1191 |