Orthologous regulated operons containing fadD2 gene
| Regulog: | PsrA - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alteromonas macleodii 'Deep ecotype' | ||||
|
Position: -110
Score: 5.62832 Sequence: ATGTAAACGCTTGTTTAAAA
Locus tag: MADE_01022
Name: fadD2 Funciton: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3) |
||||
| fadD2 | -110 | 5.6 | ATGTAAACGCTTGTTTAAAA | MADE_01022 |