Orthologous regulated operons containing etfB gene
| Regulog: | PsrA - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Colwellia psychrerythraea 34H | ||||
|
Position: -202
Score: 5.31187 Sequence: TTTCAAACGTGCGTTTGATA
Position: -183
Score: 5.65694 Sequence: ATTCAAACAAGTGTTTGATA
Locus tag: CPS_3687
Name: etfB Funciton: Electron transfer flavoprotein, beta subunit
Locus tag: CPS_3688
Name: etfA Funciton: Electron transfer flavoprotein, alpha subunit |
||||
| etfB-etfA | -202 | 5.3 | TTTCAAACGTGCGTTTGATA | CPS_3687 |
| -183 | 5.7 | ATTCAAACAAGTGTTTGATA | ||