Orthologous regulated operons containing etfD gene
| Regulog: | PsrA - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Colwellia psychrerythraea 34H | ||||
|
Position: -99
Score: 5.65128 Sequence: TATCAAACACTTGTTTGAAT
Position: -80
Score: 5.31557 Sequence: TATCAAACGCACGTTTGAAA
Locus tag: CPS_3686
Name: etfD Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1) |
||||
| etfD | -99 | 5.7 | TATCAAACACTTGTTTGAAT | CPS_3686 |
| -80 | 5.3 | TATCAAACGCACGTTTGAAA | ||