Orthologous regulated operons containing acdH2 gene
| Regulog: | PsrA - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Colwellia psychrerythraea 34H | ||||
|
Position: -80
Score: 5.65963 Sequence: AATCAAACACCTGTTTGAAA
Locus tag: CPS_1177
Name: acdH2 Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3) |
||||
| acdH2 | -80 | 5.7 | AATCAAACACCTGTTTGAAA | CPS_1177 |