Orthologous regulated operons containing fadE2 gene
| Regulog: | PsrA - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Idiomarina baltica OS145 | ||||
|
Position: -95
Score: 5.33374 Sequence: ATTCAAACAGGTGTTCAAAT
Locus tag: OS145_01812
Name: fadE2 Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| fadE2 | -95 | 5.3 | ATTCAAACAGGTGTTCAAAT | OS145_01812 |
| Idiomarina loihiensis L2TR | ||||
|
Position: -97
Score: 5.0343 Sequence: ATTCAAACGCCCGTTCAATT
Locus tag: IL1665
Name: fadE2 Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| fadE2 | -97 | 5 | ATTCAAACGCCCGTTCAATT | IL1665 |