Orthologous regulated operons containing psrA gene
| Regulog: | PsrA - Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Fatty acid degradation |
| Effector: | Oleate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Colwellia psychrerythraea 34H | ||||
|
Position: -149
Score: 5.37325 Sequence: TTTTAAACAGGTGTTTAAAC
Locus tag: CPS_1586
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family |
||||
| psrA | -149 | 5.4 | TTTTAAACAGGTGTTTAAAC | CPS_1586 |
| Idiomarina baltica OS145 | ||||
|
Position: -35
Score: 5.70119 Sequence: AATTAAACGCATGTTTAAAA
Locus tag: OS145_12684
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: OS145_12689
Name: fadE1 Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| psrA-fadE1 | -35 | 5.7 | AATTAAACGCATGTTTAAAA | OS145_12684 |
| Idiomarina loihiensis L2TR | ||||
|
Position: -38
Score: 5.32875 Sequence: GATTAAACGCATGTTTAAAT
Locus tag: IL0918
Name: psrA Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: IL0917
Name: fadE1 Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
||||
| psrA-fadE1 | -38 | 5.3 | GATTAAACGCATGTTTAAAT | IL0918 |