Orthologous regulated operons containing cooF gene
Regulog: | Rex - Desulfovibrionales |
Regulator type: | Transcription factor |
Regulator family: | Rex |
Regulation mode: | repressor |
Biological process: | Energy metabolism |
Effector: | NADH |
Phylum: | Proteobacteria/delta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||||
Position: -110
Score: 4.25022 Sequence: TTTACTATTTTTTTCACGAT
Locus tag: Ddes_1880
Name: cooM Funciton: Carbon monoxide-induced hydrogenase membrane protein CooM
Locus tag: Ddes_1881
Name: cooK Funciton: Carbon monoxide-induced hydrogenase proton translocating subunit CooK @ selenocysteine-containing
Locus tag: Ddes_1882
Name: cooL Funciton: Carbon monoxide-induced hydrogenase small subunit CooL
Locus tag: Ddes_1883
Name: cooX Funciton: Carbon monoxide-induced hydrogenase iron-sulfur protein CooX
Locus tag: Ddes_1884
Name: cooU Funciton: Carbon monoxide-induced hydrogenase NuoC-like protein CooU
Locus tag: Ddes_1885
Name: cooH Funciton: Carbon monoxide-induced hydrogenase large subunit CooH
Locus tag: Ddes_1886
Name: hypA Funciton: [NiFe] hydrogenase nickel incorporation protein HypA
Locus tag: Ddes_1887
Name: cooF Funciton: Carbon monoxide-induced dehydrogenase iron-sulfur protein CooF (EC 1.2.99.2) |
||||
cooM-cooK-cooL-cooX-cooU-cooH-hypA-cooF | -110 | 4.3 | TTTACTATTTTTTTCACGAT | Ddes_1880 |
Desulfovibrio vulgaris Hildenborough | ||||
Position: -116
Score: 4.39454 Sequence: ATTGGGAATCGATTCACAAA
Locus tag: DVU2286
Name: cooM Funciton: Carbon monoxide-induced hydrogenase membrane protein CooM
Locus tag: DVU2287
Name: cooK Funciton: Carbon monoxide-induced hydrogenase proton translocating subunit CooK @ selenocysteine-containing
Locus tag: DVU2288
Name: cooL Funciton: Carbon monoxide-induced hydrogenase small subunit CooL
Locus tag: DVU2289
Name: cooX Funciton: Carbon monoxide-induced hydrogenase iron-sulfur protein CooX
Locus tag: DVU2290
Name: cooU Funciton: Carbon monoxide-induced hydrogenase NuoC-like protein CooU
Locus tag: DVU2291
Name: cooH Funciton: Carbon monoxide-induced hydrogenase large subunit CooH
Locus tag: DVU2292
Name: hypA Funciton: [NiFe] hydrogenase nickel incorporation protein HypA
Locus tag: DVU2293
Name: cooF Funciton: Carbon monoxide-induced dehydrogenase iron-sulfur protein CooF (EC 1.2.99.2) |
||||
cooM-cooK-cooL-cooX-cooU-cooH-hypA-cooF | -116 | 4.4 | ATTGGGAATCGATTCACAAA | DVU2286 |