Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing cooK gene

Properties
Regulog: Rex - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Phylum: Proteobacteria/delta
Built upon 107 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Position: -110
Score: 4.25022
Sequence: TTTACTATTTTTTTCACGAT
Locus tag: Ddes_1880
Name: cooM
Funciton: Carbon monoxide-induced hydrogenase membrane protein CooM
Locus tag: Ddes_1881
Name: cooK
Funciton: Carbon monoxide-induced hydrogenase proton translocating subunit CooK @ selenocysteine-containing
Locus tag: Ddes_1882
Name: cooL
Funciton: Carbon monoxide-induced hydrogenase small subunit CooL
Locus tag: Ddes_1883
Name: cooX
Funciton: Carbon monoxide-induced hydrogenase iron-sulfur protein CooX
Locus tag: Ddes_1884
Name: cooU
Funciton: Carbon monoxide-induced hydrogenase NuoC-like protein CooU
Locus tag: Ddes_1885
Name: cooH
Funciton: Carbon monoxide-induced hydrogenase large subunit CooH
Locus tag: Ddes_1886
Name: hypA
Funciton: [NiFe] hydrogenase nickel incorporation protein HypA
Locus tag: Ddes_1887
Name: cooF
Funciton: Carbon monoxide-induced dehydrogenase iron-sulfur protein CooF (EC 1.2.99.2)
cooM-cooK-cooL-cooX-cooU-cooH-hypA-cooF -110 4.3 TTTACTATTTTTTTCACGAT Ddes_1880
Desulfovibrio vulgaris Hildenborough
Position: -116
Score: 4.39454
Sequence: ATTGGGAATCGATTCACAAA
Locus tag: DVU2286
Name: cooM
Funciton: Carbon monoxide-induced hydrogenase membrane protein CooM
Locus tag: DVU2287
Name: cooK
Funciton: Carbon monoxide-induced hydrogenase proton translocating subunit CooK @ selenocysteine-containing
Locus tag: DVU2288
Name: cooL
Funciton: Carbon monoxide-induced hydrogenase small subunit CooL
Locus tag: DVU2289
Name: cooX
Funciton: Carbon monoxide-induced hydrogenase iron-sulfur protein CooX
Locus tag: DVU2290
Name: cooU
Funciton: Carbon monoxide-induced hydrogenase NuoC-like protein CooU
Locus tag: DVU2291
Name: cooH
Funciton: Carbon monoxide-induced hydrogenase large subunit CooH
Locus tag: DVU2292
Name: hypA
Funciton: [NiFe] hydrogenase nickel incorporation protein HypA
Locus tag: DVU2293
Name: cooF
Funciton: Carbon monoxide-induced dehydrogenase iron-sulfur protein CooF (EC 1.2.99.2)
cooM-cooK-cooL-cooX-cooU-cooH-hypA-cooF -116 4.4 ATTGGGAATCGATTCACAAA DVU2286