Orthologous regulated operons containing rex gene

Properties
Regulog:	Rex - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	Rex
Regulation mode:	repressor
Biological process:	Energy metabolism
Effector:	NADH
Phylum:	Proteobacteria/delta

Built upon 107 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Desulfohalobium retbaense DSM 5692
Position: -19 Score: 4.54711 Sequence: ATTGTGAAATTTAGAGCAAA Locus tag: Dret_2085 Name: rex Funciton: Redox-sensing transcriptional repressor Rex
rex	-19	4.5	ATTGTGAAATTTAGAGCAAA	Dret_2085
Desulfomicrobium baculatum DSM 4028
Position: -39 Score: 4.41033 Sequence: TTAGTGAAATAACTCACGAA Locus tag: Dbac_2793 Name: rex Funciton: Redox-sensing transcriptional repressor Rex
rex	-39	4.4	TTAGTGAAATAACTCACGAA	Dbac_2793
Desulfovibrio desulfuricans G20
Position: -48 Score: 4.97804 Sequence: CTCGTTATTTATTTCACATT Locus tag: Dde_2702 Name: rex Funciton: Redox-sensing transcriptional repressor Rex
rex	-48	5	CTCGTTATTTATTTCACATT	Dde_2702
Desulfovibrio magneticus RS-1
Position: -76 Score: 4.35558 Sequence: CTTGTGAACTTGTGCACGAG Locus tag: DMR_42140 Name: atpI1 Funciton: ATP synthase protein I Locus tag: DMR_42150 Name: atpI2 Funciton: ATP synthase protein I2 Locus tag: DMR_42160 Name: atpB Funciton: ATP synthase A chain (EC 3.6.3.14) Locus tag: DMR_42170 Name: atpE Funciton: ATP synthase C chain (EC 3.6.3.14) Locus tag: DMR_42180 Name: rex Funciton: Redox-sensing transcriptional repressor Rex
atpI1-atpI2-atpB-atpE-rex	-76	4.4	CTTGTGAACTTGTGCACGAG	DMR_42140
Desulfovibrio vulgaris Hildenborough
Position: 61 Score: 4.23162 Sequence: CTTGTGAACGATTGCACGAA Locus tag: DVU0920 Name: atpI Funciton: ATP synthase protein I Locus tag: DVU0919 Name: atpI2 Funciton: ATP synthase protein I2 Locus tag: DVU0918 Name: atpB Funciton: ATP synthase A chain (EC 3.6.3.14) Locus tag: DVU0917 Name: atpE Funciton: ATP synthase C chain (EC 3.6.3.14) Locus tag: DVU0916 Name: rex Funciton: Redox-sensing transcriptional repressor Rex
atpI-atpI2-atpB-atpE-rex	61	4.2	CTTGTGAACGATTGCACGAA	DVU0920
Desulfovibrio vulgaris str. Miyazaki F
Position: -148 Score: 4.13931 Sequence: GTGGGGAATTTTTTCACGAA Position: -76 Score: 4.25999 Sequence: CTTGTGAACGTTTGCACGAA Locus tag: DvMF_1386 Name: atpI1 Funciton: ATP synthase protein I Locus tag: DvMF_1387 Name: atpI2 Funciton: ATP synthase protein I2 Locus tag: DvMF_1388 Name: atpB Funciton: ATP synthase A chain (EC 3.6.3.14) Locus tag: DvMF_1389 Name: atpE Funciton: ATP synthase C chain (EC 3.6.3.14) Locus tag: DvMF_1390 Name: rex Funciton: Redox-sensing transcriptional repressor Rex
atpI1-atpI2-atpB-atpE-rex	-148	4.1	GTGGGGAATTTTTTCACGAA	DvMF_1386
	-76	4.3	CTTGTGAACGTTTGCACGAA