Orthologous regulated operons containing atpI1 gene
| Regulog: | Rex - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | Rex |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | NADH |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfohalobium retbaense DSM 5692 | ||||
|
Position: -11
Score: 4.64444 Sequence: CTTGTGAATGAATGCACGAA
Locus tag: Dret_2089
Name: atpI1 Funciton: ATP synthase protein I
Locus tag: Dret_2088
Name: atpI2 Funciton: ATP synthase protein I2
Locus tag: Dret_2087
Name: atpB Funciton: ATP synthase A chain (EC 3.6.3.14)
Locus tag: Dret_2086
Name: atpE Funciton: ATP synthase C chain (EC 3.6.3.14) |
||||
| atpI1-atpI2-atpB-atpE | -11 | 4.6 | CTTGTGAATGAATGCACGAA | Dret_2089 |
| Desulfomicrobium baculatum DSM 4028 | ||||
|
Position: -56
Score: 5.14293 Sequence: TTTGTGATTTATTGCACGAA
Locus tag: Dbac_2797
Name: atpI1 Funciton: ATP synthase protein I
Locus tag: Dbac_2796
Name: atpI2 Funciton: ATP synthase protein I2
Locus tag: Dbac_2795
Name: atpB Funciton: ATP synthase A chain (EC 3.6.3.14)
Locus tag: Dbac_2794
Name: atpE Funciton: ATP synthase C chain (EC 3.6.3.14) |
||||
| atpI1-atpI2-atpB-atpE | -56 | 5.1 | TTTGTGATTTATTGCACGAA | Dbac_2797 |
| Desulfovibrio desulfuricans G20 | ||||
|
Position: -151
Score: 4.75327 Sequence: CTTGTGAAAAATTTCTAAAA
Position: -68
Score: 4.12426 Sequence: CTTGTGAAGGAATGCACGAA
Locus tag: Dde_2698
Name: atpI1 Funciton: ATP synthase protein I
Locus tag: Dde_2699
Name: atpI2 Funciton: ATP synthase protein I2
Locus tag: Dde_2700
Name: atpB Funciton: ATP synthase A chain (EC 3.6.3.14)
Locus tag: Dde_2701
Name: atpE Funciton: ATP synthase C chain (EC 3.6.3.14) |
||||
| atpI1-atpI2-atpB-atpE | -151 | 4.8 | CTTGTGAAAAATTTCTAAAA | Dde_2698 |
| -68 | 4.1 | CTTGTGAAGGAATGCACGAA | ||
| Desulfovibrio magneticus RS-1 | ||||
|
Position: -76
Score: 4.35558 Sequence: CTTGTGAACTTGTGCACGAG
Locus tag: DMR_42140
Name: atpI1 Funciton: ATP synthase protein I
Locus tag: DMR_42150
Name: atpI2 Funciton: ATP synthase protein I2
Locus tag: DMR_42160
Name: atpB Funciton: ATP synthase A chain (EC 3.6.3.14)
Locus tag: DMR_42170
Name: atpE Funciton: ATP synthase C chain (EC 3.6.3.14)
Locus tag: DMR_42180
Name: rex Funciton: Redox-sensing transcriptional repressor Rex |
||||
| atpI1-atpI2-atpB-atpE-rex | -76 | 4.4 | CTTGTGAACTTGTGCACGAG | DMR_42140 |
| Desulfovibrio piger ATCC 29098 | ||||
|
Position: -11
Score: 4.67558 Sequence: ATTGTGATAATTTGTACATT
Locus tag: DESPIG_02071
Name: atpI1 Funciton: ATP synthase protein I
Locus tag: DESPIG_02070
Name: atpI2 Funciton: ATP synthase protein I2
Locus tag: DESPIG_02069
Name: atpB Funciton: ATP synthase A chain (EC 3.6.3.14)
Locus tag: DESPIG_02068
Name: atpE Funciton: ATP synthase C chain (EC 3.6.3.14) |
||||
| atpI1-atpI2-atpB-atpE | -11 | 4.7 | ATTGTGATAATTTGTACATT | DESPIG_02071 |
| Desulfovibrio salexigens DSM 2638 | ||||
|
Position: -74
Score: 4.11452 Sequence: CTTGTGAAGGTTTGCGCAAA
Locus tag: Desal_3727
Name: atpI1 Funciton: ATP synthase protein I
Locus tag: Desal_3726
Name: atpI2 Funciton: ATP synthase protein I2
Locus tag: Desal_3725
Name: atpB Funciton: ATP synthase A chain (EC 3.6.3.14)
Locus tag: Desal_3724
Name: atpE Funciton: ATP synthase C chain (EC 3.6.3.14) |
||||
| atpI1-atpI2-atpB-atpE | -74 | 4.1 | CTTGTGAAGGTTTGCGCAAA | Desal_3727 |
| Desulfovibrio vulgaris Hildenborough | ||||
|
Position: 61
Score: 4.23162 Sequence: CTTGTGAACGATTGCACGAA
Locus tag: DVU0920
Name: atpI Funciton: ATP synthase protein I
Locus tag: DVU0919
Name: atpI2 Funciton: ATP synthase protein I2
Locus tag: DVU0918
Name: atpB Funciton: ATP synthase A chain (EC 3.6.3.14)
Locus tag: DVU0917
Name: atpE Funciton: ATP synthase C chain (EC 3.6.3.14)
Locus tag: DVU0916
Name: rex Funciton: Redox-sensing transcriptional repressor Rex |
||||
| atpI-atpI2-atpB-atpE-rex | 61 | 4.2 | CTTGTGAACGATTGCACGAA | DVU0920 |
| Desulfovibrio vulgaris str. Miyazaki F | ||||
|
Position: -148
Score: 4.13931 Sequence: GTGGGGAATTTTTTCACGAA
Position: -76
Score: 4.25999 Sequence: CTTGTGAACGTTTGCACGAA
Locus tag: DvMF_1386
Name: atpI1 Funciton: ATP synthase protein I
Locus tag: DvMF_1387
Name: atpI2 Funciton: ATP synthase protein I2
Locus tag: DvMF_1388
Name: atpB Funciton: ATP synthase A chain (EC 3.6.3.14)
Locus tag: DvMF_1389
Name: atpE Funciton: ATP synthase C chain (EC 3.6.3.14)
Locus tag: DvMF_1390
Name: rex Funciton: Redox-sensing transcriptional repressor Rex |
||||
| atpI1-atpI2-atpB-atpE-rex | -148 | 4.1 | GTGGGGAATTTTTTCACGAA | DvMF_1386 |
| -76 | 4.3 | CTTGTGAACGTTTGCACGAA | ||