Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hycA gene

Properties
Regulog: Rex - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Phylum: Proteobacteria/delta
Built upon 107 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio magneticus RS-1
Position: -133
Score: 5.67063
Sequence: TTTGTGAAAATAATCACAAA
Locus tag: DMR_02450
Name: hycA
Funciton: NADP-reducing Fe-hydrogenase, subunit A
Locus tag: DMR_02460
Name: hycB
Funciton: NADP-reducing hydrogenase, subunit B
Locus tag: DMR_02470
Name: hycC
Funciton: NADP-reducing Fe-hydrogenase, subunit C
Locus tag: DMR_02480
Name: hycD
Funciton: NADP-reducing Fe-hydrogenase, subunit D
hycA-hycB-hycC-hycD -133 5.7 TTTGTGAAAATAATCACAAA DMR_02450
© 2009-2020 RegPrecise