Orthologous regulated operons containing DVU2798 gene

Properties
Regulog:	Rex - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	Rex
Regulation mode:	repressor
Biological process:	Energy metabolism
Effector:	NADH
Phylum:	Proteobacteria/delta

Built upon 107 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Desulfovibrio desulfuricans G20
Position: -226 Score: 4.41555 Sequence: TATGTGAAAAATTTAATTAG Locus tag: Dde_0580 Name: dhcA Funciton: Decaheme cytochrome c associated with Rnf complex Locus tag: Dde_0581 Name: rnfC Funciton: Electron transport complex protein RnfC Locus tag: Dde_0582 Name: rnfD Funciton: Electron transport complex protein RnfD Locus tag: Dde_0583 Name: rnfG Funciton: Electron transport complex protein RnfG Locus tag: Dde_0584 Name: rnfE Funciton: Electron transport complex protein RnfE Locus tag: Dde_0585 Name: rnfA Funciton: Electron transport complex protein RnfA Locus tag: Dde_0586 Name: rnfB Funciton: Electron transport complex protein RnfB Locus tag: Dde_0587 Name: null Funciton: ApbE family lipoprotein
dhcA-rnfC-rnfD-rnfG-rnfE-rnfA-rnfB-Dde_0587	-226	4.4	TATGTGAAAAATTTAATTAG	Dde_0580
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Position: -214 Score: 4.57798 Sequence: ACTGTGAAAAATATCACCAA Locus tag: Ddes_1237 Name: dhcA Funciton: Decaheme cytochrome c associated with Rnf complex Locus tag: Ddes_1238 Name: rnfC Funciton: Electron transport complex protein RnfC Locus tag: Ddes_1239 Name: rnfD Funciton: Electron transport complex protein RnfD Locus tag: Ddes_1240 Name: rnfG Funciton: Electron transport complex protein RnfG Locus tag: Ddes_1241 Name: rnfE Funciton: Electron transport complex protein RnfE Locus tag: Ddes_1242 Name: rnfA Funciton: Electron transport complex protein RnfA Locus tag: Ddes_1243 Name: rnfB Funciton: Electron transport complex protein RnfB Locus tag: Ddes_1244 Name: null Funciton: ApbE family lipoprotein
dhcA-rnfC-rnfD-rnfG-rnfE-rnfA-rnfB-Ddes_1244	-214	4.6	ACTGTGAAAAATATCACCAA	Ddes_1237
Desulfovibrio vulgaris Hildenborough
Position: -127 Score: 4.01208 Sequence: CTTGTGAAATAATGTTCTTT Locus tag: DVU2791 Name: dhcA Funciton: Decaheme cytochrome c associated with Rnf complex Locus tag: DVU2792 Name: rnfC Funciton: Electron transport complex protein RnfC Locus tag: DVU2793 Name: rnfD Funciton: Electron transport complex protein RnfD Locus tag: DVU2794 Name: rnfG Funciton: Electron transport complex protein RnfG Locus tag: DVU2795 Name: rnfE Funciton: Electron transport complex protein RnfE Locus tag: DVU2796 Name: rnfA Funciton: Electron transport complex protein RnfA Locus tag: DVU2797 Name: rnfB Funciton: Electron transport complex protein RnfB Locus tag: DVU2798 Name: null Funciton: ApbE family lipoprotein
dhcA-rnfC-rnfD-rnfG-rnfE-rnfA-rnfB-DVU2798	-127	4	CTTGTGAAATAATGTTCTTT	DVU2791