Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing rnfE gene

Properties
Regulog: Rex - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Phylum: Proteobacteria/delta
Built upon 107 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio desulfuricans G20
Position: -226
Score: 4.41555
Sequence: TATGTGAAAAATTTAATTAG
Locus tag: Dde_0580
Name: dhcA
Funciton: Decaheme cytochrome c associated with Rnf complex
Locus tag: Dde_0581
Name: rnfC
Funciton: Electron transport complex protein RnfC
Locus tag: Dde_0582
Name: rnfD
Funciton: Electron transport complex protein RnfD
Locus tag: Dde_0583
Name: rnfG
Funciton: Electron transport complex protein RnfG
Locus tag: Dde_0584
Name: rnfE
Funciton: Electron transport complex protein RnfE
Locus tag: Dde_0585
Name: rnfA
Funciton: Electron transport complex protein RnfA
Locus tag: Dde_0586
Name: rnfB
Funciton: Electron transport complex protein RnfB
Locus tag: Dde_0587
Name: null
Funciton: ApbE family lipoprotein
dhcA-rnfC-rnfD-rnfG-rnfE-rnfA-rnfB-Dde_0587 -226 4.4 TATGTGAAAAATTTAATTAG Dde_0580
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Position: -214
Score: 4.57798
Sequence: ACTGTGAAAAATATCACCAA
Locus tag: Ddes_1237
Name: dhcA
Funciton: Decaheme cytochrome c associated with Rnf complex
Locus tag: Ddes_1238
Name: rnfC
Funciton: Electron transport complex protein RnfC
Locus tag: Ddes_1239
Name: rnfD
Funciton: Electron transport complex protein RnfD
Locus tag: Ddes_1240
Name: rnfG
Funciton: Electron transport complex protein RnfG
Locus tag: Ddes_1241
Name: rnfE
Funciton: Electron transport complex protein RnfE
Locus tag: Ddes_1242
Name: rnfA
Funciton: Electron transport complex protein RnfA
Locus tag: Ddes_1243
Name: rnfB
Funciton: Electron transport complex protein RnfB
Locus tag: Ddes_1244
Name: null
Funciton: ApbE family lipoprotein
dhcA-rnfC-rnfD-rnfG-rnfE-rnfA-rnfB-Ddes_1244 -214 4.6 ACTGTGAAAAATATCACCAA Ddes_1237
Desulfovibrio vulgaris Hildenborough
Position: -127
Score: 4.01208
Sequence: CTTGTGAAATAATGTTCTTT
Locus tag: DVU2791
Name: dhcA
Funciton: Decaheme cytochrome c associated with Rnf complex
Locus tag: DVU2792
Name: rnfC
Funciton: Electron transport complex protein RnfC
Locus tag: DVU2793
Name: rnfD
Funciton: Electron transport complex protein RnfD
Locus tag: DVU2794
Name: rnfG
Funciton: Electron transport complex protein RnfG
Locus tag: DVU2795
Name: rnfE
Funciton: Electron transport complex protein RnfE
Locus tag: DVU2796
Name: rnfA
Funciton: Electron transport complex protein RnfA
Locus tag: DVU2797
Name: rnfB
Funciton: Electron transport complex protein RnfB
Locus tag: DVU2798
Name: null
Funciton: ApbE family lipoprotein
dhcA-rnfC-rnfD-rnfG-rnfE-rnfA-rnfB-DVU2798 -127 4 CTTGTGAAATAATGTTCTTT DVU2791