Orthologous regulated operons containing qrcD gene
| Regulog: | Rex - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | Rex |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | NADH |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfohalobium retbaense DSM 5692 | ||||
|
Position: -176
Score: 4.83098 Sequence: ATCGTGAAATTTTTCATGAG
Position: -102
Score: 4.70273 Sequence: CTCGTGAAATTGTGCACAGG
Locus tag: Dret_0270
Name: qrcA Funciton: cytochrome c class III family protein
Locus tag: Dret_0271
Name: qrcB Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
Locus tag: Dret_0272
Name: qrcC Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
Locus tag: Dret_0273
Name: qrcD Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative |
||||
| qrcA-qrcB-qrcC-qrcD | -176 | 4.8 | ATCGTGAAATTTTTCATGAG | Dret_0270 |
| -102 | 4.7 | CTCGTGAAATTGTGCACAGG | ||
| Desulfomicrobium baculatum DSM 4028 | ||||
|
Position: -116
Score: 4.52435 Sequence: ATCGTGATTTTTTTCATTAT
Locus tag: Dbac_3390
Name: qrcA Funciton: cytochrome c class III family protein
Locus tag: Dbac_3391
Name: qrcB Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
Locus tag: Dbac_3392
Name: qrcC Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
Locus tag: Dbac_3393
Name: qrcD Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative |
||||
| qrcA-qrcB-qrcC-qrcD | -116 | 4.5 | ATCGTGATTTTTTTCATTAT | Dbac_3390 |
| Desulfovibrio desulfuricans G20 | ||||
|
Position: -110
Score: 4.95108 Sequence: TTCGTGAATTTTTTCACCTT
Locus tag: Dde_2932
Name: qrcA Funciton: cytochrome c class III family protein
Locus tag: Dde_2933
Name: qrcB Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
Locus tag: Dde_2934
Name: qrcC Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
Locus tag: Dde_2935
Name: qrcD Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative |
||||
| qrcA-qrcB-qrcC-qrcD | -110 | 5 | TTCGTGAATTTTTTCACCTT | Dde_2932 |
| Desulfovibrio magneticus RS-1 | ||||
|
Position: -217
Score: 4.97681 Sequence: TTCGTGAATTTTTTCATTAG
Locus tag: DMR_18010
Name: qrcA Funciton: cytochrome c class III family protein
Locus tag: DMR_18020
Name: qrcB Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
Locus tag: DMR_18030
Name: qrcC Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
Locus tag: DMR_18040
Name: qrcD Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative |
||||
| qrcA-qrcB-qrcC-qrcD | -217 | 5 | TTCGTGAATTTTTTCATTAG | DMR_18010 |
| Desulfovibrio salexigens DSM 2638 | ||||
|
Position: -112
Score: 4.82794 Sequence: TTTGTGAAAAGTTTCATATT
Locus tag: Desal_1042
Name: qrcA Funciton: cytochrome c class III family protein
Locus tag: Desal_1043
Name: qrcB Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
Locus tag: Desal_1044
Name: qrcC Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
Locus tag: Desal_1045
Name: qrcD Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative |
||||
| qrcA-qrcB-qrcC-qrcD | -112 | 4.8 | TTTGTGAAAAGTTTCATATT | Desal_1042 |
| Desulfovibrio vulgaris Hildenborough | ||||
|
Position: -755
Score: 5.05807 Sequence: TTCGTGAAATATTTCACCTT
Locus tag: DVU0694
Name: qrcB Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
Locus tag: DVU0693
Name: qrcC Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
Locus tag: DVU0692
Name: qrcD Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative |
||||
| qrcB-qrcC-qrcD | -755 | 5.1 | TTCGTGAAATATTTCACCTT | DVU0694 |
| Desulfovibrio vulgaris str. Miyazaki F | ||||
|
Position: -112
Score: 5.05807 Sequence: TTCGTGAAATATTTCACCTT
Locus tag: DvMF_2690
Name: qrcA Funciton: cytochrome c class III family protein
Locus tag: DvMF_2689
Name: qrcB Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative
Locus tag: DvMF_2688
Name: qrcC Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative
Locus tag: DvMF_2687
Name: qrcD Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative |
||||
| qrcA-qrcB-qrcC-qrcD | -112 | 5.1 | TTCGTGAAATATTTCACCTT | DvMF_2690 |