Orthologous regulated operons containing qrcD gene

Properties
Regulog:	Rex - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	Rex
Regulation mode:	repressor
Biological process:	Energy metabolism
Effector:	NADH
Phylum:	Proteobacteria/delta

Built upon 107 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Desulfohalobium retbaense DSM 5692
Position: -176 Score: 4.83098 Sequence: ATCGTGAAATTTTTCATGAG Position: -102 Score: 4.70273 Sequence: CTCGTGAAATTGTGCACAGG Locus tag: Dret_0270 Name: qrcA Funciton: cytochrome c class III family protein Locus tag: Dret_0271 Name: qrcB Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative Locus tag: Dret_0272 Name: qrcC Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative Locus tag: Dret_0273 Name: qrcD Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative
qrcA-qrcB-qrcC-qrcD	-176	4.8	ATCGTGAAATTTTTCATGAG	Dret_0270
	-102	4.7	CTCGTGAAATTGTGCACAGG
Desulfomicrobium baculatum DSM 4028
Position: -116 Score: 4.52435 Sequence: ATCGTGATTTTTTTCATTAT Locus tag: Dbac_3390 Name: qrcA Funciton: cytochrome c class III family protein Locus tag: Dbac_3391 Name: qrcB Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative Locus tag: Dbac_3392 Name: qrcC Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative Locus tag: Dbac_3393 Name: qrcD Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative
qrcA-qrcB-qrcC-qrcD	-116	4.5	ATCGTGATTTTTTTCATTAT	Dbac_3390
Desulfovibrio desulfuricans G20
Position: -110 Score: 4.95108 Sequence: TTCGTGAATTTTTTCACCTT Locus tag: Dde_2932 Name: qrcA Funciton: cytochrome c class III family protein Locus tag: Dde_2933 Name: qrcB Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative Locus tag: Dde_2934 Name: qrcC Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative Locus tag: Dde_2935 Name: qrcD Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative
qrcA-qrcB-qrcC-qrcD	-110	5	TTCGTGAATTTTTTCACCTT	Dde_2932
Desulfovibrio magneticus RS-1
Position: -217 Score: 4.97681 Sequence: TTCGTGAATTTTTTCATTAG Locus tag: DMR_18010 Name: qrcA Funciton: cytochrome c class III family protein Locus tag: DMR_18020 Name: qrcB Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative Locus tag: DMR_18030 Name: qrcC Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative Locus tag: DMR_18040 Name: qrcD Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative
qrcA-qrcB-qrcC-qrcD	-217	5	TTCGTGAATTTTTTCATTAG	DMR_18010
Desulfovibrio salexigens DSM 2638
Position: -112 Score: 4.82794 Sequence: TTTGTGAAAAGTTTCATATT Locus tag: Desal_1042 Name: qrcA Funciton: cytochrome c class III family protein Locus tag: Desal_1043 Name: qrcB Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative Locus tag: Desal_1044 Name: qrcC Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative Locus tag: Desal_1045 Name: qrcD Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative
qrcA-qrcB-qrcC-qrcD	-112	4.8	TTTGTGAAAAGTTTCATATT	Desal_1042
Desulfovibrio vulgaris Hildenborough
Position: -755 Score: 5.05807 Sequence: TTCGTGAAATATTTCACCTT Locus tag: DVU0694 Name: qrcB Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative Locus tag: DVU0693 Name: qrcC Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative Locus tag: DVU0692 Name: qrcD Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative
qrcB-qrcC-qrcD	-755	5.1	TTCGTGAAATATTTCACCTT	DVU0694
Desulfovibrio vulgaris str. Miyazaki F
Position: -112 Score: 5.05807 Sequence: TTCGTGAAATATTTCACCTT Locus tag: DvMF_2690 Name: qrcA Funciton: cytochrome c class III family protein Locus tag: DvMF_2689 Name: qrcB Funciton: molybdopterin oxidoreductase, molybdopterin-binding subunit, putative Locus tag: DvMF_2688 Name: qrcC Funciton: molybdopterin oxidoreductase, iron-sulfur cluster-binding subunit, putative Locus tag: DvMF_2687 Name: qrcD Funciton: molybdopterin oxidoreductase, transmembrane subunit, putative
qrcA-qrcB-qrcC-qrcD	-112	5.1	TTCGTGAAATATTTCACCTT	DvMF_2690

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing qrcD gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --