Orthologous regulated operons containing nifN gene
| Regulog: | ModE2 - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor |
| Biological process: | Molybdopterin biosynthesis; Molybdenum homeostasis |
| Effector: | Molybdenum |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfovibrio magneticus RS-1 | ||||
|
Position: -312
Score: 4.75058 Sequence: GTTGTGTCAAAACAGACAGAAG
Locus tag: DMR_17520
Name: nifE Funciton: Nitrogenase FeMo-cofactor scaffold and assembly protein NifE
Locus tag: DMR_17510
Name: nifN Funciton: Nitrogenase FeMo-cofactor scaffold and assembly protein NifN
Locus tag: DMR_17500
Name: nifB Funciton: Nitrogenase FeMo-cofactor synthesis FeS core scaffold and assembly protein NifB |
||||
| nifE-nifN-nifB | -312 | 4.8 | GTTGTGTCAAAACAGACAGAAG | DMR_17520 |