Orthologous regulated operons containing nifE gene

Properties
Regulog:	ModE2 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor
Biological process:	Molybdopterin biosynthesis; Molybdenum homeostasis
Effector:	Molybdenum
Phylum:	Proteobacteria/delta

Built upon 48 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Desulfovibrio magneticus RS-1
Position: -312 Score: 4.75058 Sequence: GTTGTGTCAAAACAGACAGAAG Locus tag: DMR_17520 Name: nifE Funciton: Nitrogenase FeMo-cofactor scaffold and assembly protein NifE Locus tag: DMR_17510 Name: nifN Funciton: Nitrogenase FeMo-cofactor scaffold and assembly protein NifN Locus tag: DMR_17500 Name: nifB Funciton: Nitrogenase FeMo-cofactor synthesis FeS core scaffold and assembly protein NifB
nifE-nifN-nifB	-312	4.8	GTTGTGTCAAAACAGACAGAAG	DMR_17520

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --