Orthologous regulated operons containing wtpA gene

Properties
Regulog:	ModE2 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor
Biological process:	Molybdopterin biosynthesis; Molybdenum homeostasis
Effector:	Molybdenum
Phylum:	Proteobacteria/delta

Built upon 48 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Desulfohalobium retbaense DSM 5692
Position: -32 Score: 4.40957 Sequence: TATATGTCTTTTTTAGCAAAGG Locus tag: Dret_0525 Name: wtpA Funciton: ABC-type tungstate/molybdate transport system, periplasmic component Locus tag: Dret_0526 Name: wtpB Funciton: ABC-type tungstate/molybdate transport system, permease protein Locus tag: Dret_0527 Name: wtpC Funciton: ABC-type tungstate/molybdate transport system, ATP-binding component
wtpA-wtpB-wtpC	-32	4.4	TATATGTCTTTTTTAGCAAAGG	Dret_0525
Desulfomicrobium baculatum DSM 4028
Position: -76 Score: 4.37373 Sequence: TTTCTGTCTTTGTTGACTTAAA Locus tag: Dbac_2354 Name: wtpA Funciton: ABC-type tungstate/molybdate transport system, periplasmic component
wtpA	-76	4.4	TTTCTGTCTTTGTTGACTTAAA	Dbac_2354
Desulfovibrio salexigens DSM 2638
Position: -106 Score: 5.02761 Sequence: ATTATGCTCTCCATGACATATG Locus tag: Desal_2416 Name: wtpA Funciton: ABC-type tungstate/molybdate transport system, periplasmic component Locus tag: Desal_2417 Name: wtpB Funciton: ABC-type tungstate/molybdate transport system, permease protein Locus tag: Desal_2418 Name: wtpC Funciton: ABC-type tungstate/molybdate transport system, ATP-binding component
wtpA-wtpB-wtpC	-106	5	ATTATGCTCTCCATGACATATG	Desal_2416

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --