Orthologous regulated operons containing Dde_0715 gene

Properties
Regulog:	ModE2 - Desulfovibrionales
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor
Biological process:	Molybdopterin biosynthesis; Molybdenum homeostasis
Effector:	Molybdenum
Phylum:	Proteobacteria/delta

Built upon 48 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Desulfohalobium retbaense DSM 5692
Position: -10 Score: 4.96014 Sequence: GTTATGTTTTATGAGGCATAAC Locus tag: Dret_0225 Name: null Funciton: hypothetical protein Locus tag: Dret_0226 Name: null Funciton: formate dehydrogenase, alpha subunit Locus tag: Dret_0227 Name: null Funciton: formate dehydrogenase, beta subunit
Dret_0225-Dret_0226-Dret_0227	-10	5	GTTATGTTTTATGAGGCATAAC	Dret_0225
Desulfovibrio desulfuricans G20
Position: -177 Score: 5.36046 Sequence: GTTCTGCTATTATTAACATATT Locus tag: Dde_0715 Name: null Funciton: hypothetical protein Locus tag: Dde_0716 Name: null Funciton: formate dehydrogenase, alpha subunit Locus tag: Dde_0717 Name: null Funciton: formate dehydrogenase, alpha subunit Locus tag: Dde_0718 Name: , Funciton: formate dehydrogenase, beta subunit
Dde_0715-Dde_0716-Dde_0717-,	-177	5.4	GTTCTGCTATTATTAACATATT	Dde_0715
Desulfovibrio vulgaris Hildenborough
Position: -170 Score: 4.60097 Sequence: TGTGTGTTAATTGTAACATATT Locus tag: DVU0586 Name: null Funciton: hypothetical protein Locus tag: DVU0587 Name: fdnG-1 Funciton: formate dehydrogenase, alpha subunit Locus tag: DVU0588 Name: hybA Funciton: formate dehydrogenase, beta subunit
DVU0586-fdnG-1-hybA	-170	4.6	TGTGTGTTAATTGTAACATATT	DVU0586

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --