Orthologous regulated operons containing gntK gene
| Regulog: | GntR - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella baltica OS155 | ||||
|
Position: -30
Score: 5.72335 Sequence: GTAGGTTACCGGTAACATGT
Position: -16
Score: 5.6101 Sequence: ACATGTTACCCGTAATATGA
Locus tag: Sbal_4087
Name: gntK Funciton: Gluconokinase (EC 2.7.1.12) |
||||
| gntK | -30 | 5.7 | GTAGGTTACCGGTAACATGT | Sbal_4087 |
| -16 | 5.6 | ACATGTTACCCGTAATATGA | ||