Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing RL2581 gene

Properties
Regulog: Irr - Rhizobiales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 122 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhizobium leguminosarum bv. viciae 3841
Position: -134
Score: 6.55074
Sequence: AGTTTAGAACAATTCGAAACT
Locus tag: RL2583
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: RL2582
Name: sufB
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: RL2581
Name: null
Funciton: hypothetical protein
Locus tag: RL2580
Name: sufC
Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
Locus tag: RL2579
Name: sufD
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: RL2578
Name: sufS1
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: RL2577
Name: PF01883
Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
Locus tag: RL2576
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
sufS2-sufB-RL2581-sufC-sufD-sufS1-PF01883-sufA -134 6.6 AGTTTAGAACAATTCGAAACT RL2583
© 2009-2020 RegPrecise