Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing sufD gene

Properties
Regulog: Irr - Rhizobiales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 122 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -125
Score: 6.63346
Sequence: AGTTTAGAATAATTCGAAACT
Locus tag: Atu1825
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: Atu1824
Name: sufB
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: Atu1823
Name: sufC
Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
Locus tag: Atu1822
Name: sufD
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: Atu1821
Name: sufS1
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: Atu1820
Name: PF01883
Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
Locus tag: Atu1819
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
sufS2-sufB-sufC-sufD-sufS1-PF01883-sufA -125 6.6 AGTTTAGAATAATTCGAAACT Atu1825
Azorhizobium caulinodans ORS 571
Position: -99
Score: 5.96998
Sequence: TATTTAGAATAATTCTAATGT
Locus tag: AZC_3616
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: AZC_3615
Name: sufB
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: AZC_3614
Name: sufC
Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
Locus tag: AZC_3613
Name: sufD
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: AZC_3612
Name: sufS1
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: AZC_3611
Name: PF01883
Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
Locus tag: AZC_3610
Name: PF00903
Funciton: putative lactoylglutathione lyase
Locus tag: AZC_3609
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
sufS2-sufB-sufC-sufD-sufS1-PF01883-PF00903-sufA -99 6 TATTTAGAATAATTCTAATGT AZC_3616
Bartonella quintana str. Toulouse
Position: -148
Score: 5.18347
Sequence: GAATTAGAATTATTTTAAAAA
Locus tag: BQ05950
Name: sufB
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: BQ05960
Name: sufC
Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
Locus tag: BQ05970
Name: sufD
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: BQ05980
Name: sufS1
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: BQ05990
Name: PF01883
Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
sufB-sufC-sufD-sufS1-PF01883 -148 5.2 GAATTAGAATTATTTTAAAAA BQ05950
Brucella melitensis 16M
Position: -119
Score: 4.84057
Sequence: AGTTTAGAGAGGTTTTAAAGA
Locus tag: BMEI1043
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: BMEI1042
Name: sufB
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: BMEI1041
Name: sufC
Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
Locus tag: BMEI1040
Name: sufD
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: BMEI1039
Name: sufS1
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: BMEI1038
Name: PF01883
Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
sufS2-sufB-sufC-sufD-sufS1-PF01883 -119 4.8 AGTTTAGAGAGGTTTTAAAGA BMEI1043
Mesorhizobium loti MAFF303099
Position: -150
Score: 6.57591
Sequence: AGTTTAGAACTATTCAAAACT
Locus tag: mlr0015
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: mlr0016
Name: sufB
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: mlr0017
Name: null
Funciton: unknown protein
Locus tag: mlr0019
Name: sufC
Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
Locus tag: mlr0020
Name: sufD
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: mlr0021
Name: sufS1
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: mlr0023
Name: PF01883
Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
Locus tag: mlr0024
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
sufS2-sufB-mlr0017-sufC-sufD-sufS1-PF01883-sufA -150 6.6 AGTTTAGAACTATTCAAAACT mlr0015
Mesorhizobium sp. BNC1
Position: -131
Score: 6.49319
Sequence: AGTTTAGAACTGTTCAAAACT
Locus tag: Meso_1782
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: Meso_1781
Name: sufB
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: Meso_1780
Name: sufC
Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
Locus tag: Meso_1779
Name: sufD
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: Meso_1778
Name: sufS1
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: Meso_1777
Name: PF01883
Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
Locus tag: Meso_1776
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
sufS2-sufB-sufC-sufD-sufS1-PF01883-sufA -131 6.5 AGTTTAGAACTGTTCAAAACT Meso_1782
Rhizobium etli CFN 42
Position: -206
Score: 6.55074
Sequence: AGTTTAGAACAATTCGAAACT
Locus tag: RHE_CH02254
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: RHE_CH02253
Name: sufB
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: RHE_CH02252
Name: PF01541
Funciton: Excinuclease ABC, C subunit-like
Locus tag: RHE_CH02251
Name: sufC
Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
Locus tag: RHE_CH02250
Name: sufD
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: RHE_CH02249
Name: sufS1
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: RHE_CH02248
Name: PF01883
Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
Locus tag: RHE_CH02247
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
sufS2-sufB-PF01541-sufC-sufD-sufS1-PF01883-sufA -206 6.6 AGTTTAGAACAATTCGAAACT RHE_CH02254
Rhizobium leguminosarum bv. viciae 3841
Position: -134
Score: 6.55074
Sequence: AGTTTAGAACAATTCGAAACT
Locus tag: RL2583
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: RL2582
Name: sufB
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: RL2581
Name: null
Funciton: hypothetical protein
Locus tag: RL2580
Name: sufC
Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
Locus tag: RL2579
Name: sufD
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: RL2578
Name: sufS1
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: RL2577
Name: PF01883
Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
Locus tag: RL2576
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
sufS2-sufB-RL2581-sufC-sufD-sufS1-PF01883-sufA -134 6.6 AGTTTAGAACAATTCGAAACT RL2583
Rhizobium sp. NGR234
Position: -140
Score: 6.17259
Sequence: ACTTTAGAACCGTTCAAAACT
Locus tag: NGR_c15400
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: NGR_c15410
Name: sufB
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: NGR_c15420
Name: sufC
Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
Locus tag: NGR_c15430
Name: sufD
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: NGR_c15440
Name: sufS1
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: NGR_c15450
Name: PF01883
Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
Locus tag: NGR_c15460
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
sufS2-sufB-sufC-sufD-sufS1-PF01883-sufA -140 6.2 ACTTTAGAACCGTTCAAAACT NGR_c15400
Sinorhizobium meliloti 1021
Position: -133
Score: 6.17259
Sequence: ACTTTAGAACCGTTCAAAACT
Locus tag: SMc00529
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: SMc00530
Name: sufB
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: SMc00531
Name: sufC
Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
Locus tag: SMc00532
Name: sufD
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: SMc00533
Name: sufS1
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: SMc00302
Name: PF01883
Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
Locus tag: SMc00301
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
sufS2-sufB-sufC-sufD-sufS1-PF01883-sufA -133 6.2 ACTTTAGAACCGTTCAAAACT SMc00529
Xanthobacter autotrophicus Py2
Position: -158
Score: 6.03007
Sequence: GATTTAGAATAATTCTAATCT
Locus tag: Xaut_4470
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: Xaut_4469
Name: sufB
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: Xaut_4468
Name: sufC
Funciton: ABC transporter involved in Fe-S cluster assembly, ATP-binding protein
Locus tag: Xaut_4467
Name: sufD
Funciton: ABC transporter involved in Fe-S cluster assembly, permease protein
Locus tag: Xaut_4466
Name: sufS1
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: Xaut_4465
Name: PF01883
Funciton: PaaD-like protein (DUF59) involved in Fe-S cluster assembly
Locus tag: Xaut_4464
Name: PF00903
Funciton: putative lactoylglutathione lyase
sufS2-sufB-sufC-sufD-sufS1-PF01883-PF00903 -158 6 GATTTAGAATAATTCTAATCT Xaut_4470