Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing cbrD gene

Properties
Regulog: Irr - Rhizobiales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 122 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Azorhizobium caulinodans ORS 571
Position: -155
Score: 5.11583
Sequence: TGTTTGGAATAAATCGAAAAA
Locus tag: AZC_0183
Name: cbrA
Funciton: iron siderophore ABC transporter, ATPase protein
Locus tag: AZC_0184
Name: cbrB
Funciton: iron siderophore ABC transporter, permease protein
Locus tag: AZC_0185
Name: cbrC
Funciton: iron siderophore ABC transporter, permease protein
Locus tag: AZC_0186
Name: cbrD
Funciton: iron siderophore ABC transporter, substrate bindiing protein
cbrA-cbrB-cbrC-cbrD -155 5.1 TGTTTGGAATAAATCGAAAAA AZC_0183
© 2009-2020 RegPrecise