Orthologous regulated operons containing coxL gene
| Regulog: | Irr - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Heme |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bradyrhizobium japonicum USDA 110 | ||||
|
Position: -52
Score: 5.08099 Sequence: TGATTTGAACAGTTCCAATTT
Locus tag: bll2737
Name: coxS Funciton: Isoquinoline 1-oxidoreductase alpha subunit (EC 1.3.99.16)
Locus tag: bll2736
Name: coxL Funciton: Isoquinoline 1-oxidoreductase beta subunit (EC 1.3.99.16) |
||||
| coxS-coxL | -52 | 5.1 | TGATTTGAACAGTTCCAATTT | bll2737 |