Orthologous regulated operons containing piuB gene
| Regulog: | Irr - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Heme |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bradyrhizobium japonicum USDA 110 | ||||
|
Position: -116
Score: 5.13388 Sequence: CGCTTAGAACCATTCAACACT
Locus tag: bll7968
Name: fhuA3 Funciton: Ferrichrome-iron outer membrane receptor
Locus tag: bll7967
Name: piuB Funciton: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB |
||||
| fhuA3-piuB | -116 | 5.1 | CGCTTAGAACCATTCAACACT | bll7968 |