Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing piuB gene

Properties
Regulog: Irr - Rhizobiales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 122 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bradyrhizobium japonicum USDA 110
Position: -116
Score: 5.13388
Sequence: CGCTTAGAACCATTCAACACT
Locus tag: bll7968
Name: fhuA3
Funciton: Ferrichrome-iron outer membrane receptor
Locus tag: bll7967
Name: piuB
Funciton: Uncharacterized iron-regulated membrane protein; Iron-uptake factor PiuB
fhuA3-piuB -116 5.1 CGCTTAGAACCATTCAACACT bll7968
© 2009-2020 RegPrecise