Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing fatC gene

Properties
Regulog: Irr - Rhizobiales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 122 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -130
Score: 5.32581
Sequence: AATTCAGAACCGTTCTAAAAC
Locus tag: Atu2473
Name: fatB
Funciton: iron siderophore ABC transporter, periplasmic protein
Locus tag: Atu2474
Name: fatD
Funciton: iron siderophore ABC transporter, permease protein
Locus tag: Atu2475
Name: fatC
Funciton: iron siderophore ABC transporter, permease protein
Locus tag: Atu2476
Name: fatE
Funciton: iron siderophore ABC transporter, ATPase protein
fatB-fatD-fatC-fatE -130 5.3 AATTCAGAACCGTTCTAAAAC Atu2473
© 2009-2020 RegPrecise