Orthologous regulated operons containing fatC gene
| Regulog: | Irr - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Heme |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||||
|
Position: -130
Score: 5.32581 Sequence: AATTCAGAACCGTTCTAAAAC
Locus tag: Atu2473
Name: fatB Funciton: iron siderophore ABC transporter, periplasmic protein
Locus tag: Atu2474
Name: fatD Funciton: iron siderophore ABC transporter, permease protein
Locus tag: Atu2475
Name: fatC Funciton: iron siderophore ABC transporter, permease protein
Locus tag: Atu2476
Name: fatE Funciton: iron siderophore ABC transporter, ATPase protein |
||||
| fatB-fatD-fatC-fatE | -130 | 5.3 | AATTCAGAACCGTTCTAAAAC | Atu2473 |