Orthologous regulated operons containing SMc00065 gene
| Regulog: | Irr - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Heme |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Rhizobium leguminosarum bv. viciae 3841 | ||||
|
Position: -107
Score: 5.46495 Sequence: AGTCGAGAACAGTTCTAAACA
Locus tag: RL1432
Name: null Funciton: Hypothetical signal peptide protein
Locus tag: RL1433
Name: feuP Funciton: two component transcriptional regulator
Locus tag: RL1434
Name: feuQ Funciton: two-component sensor histidine kinase
Locus tag: RL1435
Name: lipA Funciton: outer membrane lipoprotein
Locus tag: RL1436
Name: cycH Funciton: Cytochrome c heme lyase subunit CcmH
Locus tag: RL1437
Name: cycJ Funciton: Cytochrome c-type biogenesis protein, heme chaperone
Locus tag: RL1438
Name: cycK Funciton: Cytochrome c heme lyase subunit cycK
Locus tag: RL1439
Name: cycL Funciton: Cytochrome c heme lyase subunit CcmL |
||||
| RL1432-feuP-feuQ-lipA-cycH-cycJ-cycK-cycL | -107 | 5.5 | AGTCGAGAACAGTTCTAAACA | RL1432 |