Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing cycK gene

Properties
Regulog: Irr - Rhizobiales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 122 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhizobium leguminosarum bv. viciae 3841
Position: -107
Score: 5.46495
Sequence: AGTCGAGAACAGTTCTAAACA
Locus tag: RL1432
Name: null
Funciton: Hypothetical signal peptide protein
Locus tag: RL1433
Name: feuP
Funciton: two component transcriptional regulator
Locus tag: RL1434
Name: feuQ
Funciton: two-component sensor histidine kinase
Locus tag: RL1435
Name: lipA
Funciton: outer membrane lipoprotein
Locus tag: RL1436
Name: cycH
Funciton: Cytochrome c heme lyase subunit CcmH
Locus tag: RL1437
Name: cycJ
Funciton: Cytochrome c-type biogenesis protein, heme chaperone
Locus tag: RL1438
Name: cycK
Funciton: Cytochrome c heme lyase subunit cycK
Locus tag: RL1439
Name: cycL
Funciton: Cytochrome c heme lyase subunit CcmL
RL1432-feuP-feuQ-lipA-cycH-cycJ-cycK-cycL -107 5.5 AGTCGAGAACAGTTCTAAACA RL1432