Orthologous regulated operons containing irgA gene
| Regulog: | Irr - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Heme |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||||
|
Position: -92
Score: 5.74759 Sequence: AATTTAGAACTGTTCGAAAAC
Locus tag: Atu3916
Name: irgA Funciton: iron-regulated outer membrane receptor irgA |
||||
| irgA | -92 | 5.7 | AATTTAGAACTGTTCGAAAAC | Atu3916 |