Orthologous regulated operons containing COG0348 gene
| Regulog: | Irr - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Heme |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Brucella melitensis 16M | ||||
|
Position: -137
Score: 6.02482 Sequence: TGTTTAGAATTGATCTAAACT
Locus tag: BMEII0885
Name: tpd Funciton: Periplasmic protein p19 involved in high-affinity Fe2+ transport
Locus tag: BMEII0884
Name: null Funciton: putative exported protein
Locus tag: BMEII0883
Name: ftr1 Funciton: High-affinity Fe2+/Pb2+ permease
Locus tag: BMEII0882
Name: COG0348 Funciton: Polyferredoxin |
||||
| tpd-BMEII0884-ftr1-COG0348 | -137 | 6 | TGTTTAGAATTGATCTAAACT | BMEII0885 |