Orthologous regulated operons containing fhuA gene

Properties
Regulog:	Irr - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Phylum:	Proteobacteria/alpha

Built upon 122 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -168 Score: 5.57018 Sequence: AGATTTGAATAATTCCAAGCT Locus tag: Atu4022 Name: fhuA Funciton: Ferric hydroxamate outer membrane receptor FhuA Locus tag: Atu4023 Name: fhuD Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD Locus tag: Atu4024 Name: fhuB Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB Locus tag: Atu4025 Name: fhuC Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
fhuA-fhuD-fhuB-fhuC	-168	5.6	AGATTTGAATAATTCCAAGCT	Atu4022
Azorhizobium caulinodans ORS 571
Position: -53 Score: 5.29146 Sequence: AGATTTGAATACTTCTGAACT Locus tag: AZC_1626 Name: fhuA Funciton: Ferric hydroxamate outer membrane receptor FhuA Locus tag: AZC_1625 Name: fhuC Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC Locus tag: AZC_1624 Name: fhuD Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD Locus tag: AZC_1623 Name: fhuB Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB Locus tag: AZC_1622 Name: PF08021 Funciton: iron-chelator utilization protein
fhuA-fhuC-fhuD-fhuB-PF08021	-53	5.3	AGATTTGAATACTTCTGAACT	AZC_1626
Rhodopseudomonas palustris CGA009
Position: -223 Score: 5.46425 Sequence: TGATTTGAACGATTCAAAAAT Locus tag: RPA1876 Name: fhuA Funciton: Ferric hydroxamate outer membrane receptor FhuA Locus tag: RPA1875 Name: PF03929 Funciton: putative iron-regulated membrane protein
fhuA-PF03929	-223	5.5	TGATTTGAACGATTCAAAAAT	RPA1876