Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF08021 gene

Properties
Regulog: Irr - Rhizobiales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 122 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Azorhizobium caulinodans ORS 571
Position: -53
Score: 5.29146
Sequence: AGATTTGAATACTTCTGAACT
Locus tag: AZC_1626
Name: fhuA
Funciton: Ferric hydroxamate outer membrane receptor FhuA
Locus tag: AZC_1625
Name: fhuC
Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), ATP-binding protein FhuC
Locus tag: AZC_1624
Name: fhuD
Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), periplasmic substrate binding protein FhuD
Locus tag: AZC_1623
Name: fhuB
Funciton: Ferric hydroxamate ABC transporter (TC 3.A.1.14.3), permease component FhuB
Locus tag: AZC_1622
Name: PF08021
Funciton: iron-chelator utilization protein
fhuA-fhuC-fhuD-fhuB-PF08021 -53 5.3 AGATTTGAATACTTCTGAACT AZC_1626