Orthologous regulated operons containing PF00033 gene
| Regulog: | Irr - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Heme |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Azorhizobium caulinodans ORS 571 | ||||
|
Position: -38
Score: 5.19217 Sequence: AGTCTGGACCGGTTCTAAACA
Locus tag: AZC_4058
Name: PF00033 Funciton: cytochrome b561 |
||||
| PF00033 | -38 | 5.2 | AGTCTGGACCGGTTCTAAACA | AZC_4058 |
| Mesorhizobium loti MAFF303099 | ||||
|
Position: -32
Score: 5.3398 Sequence: AGCTTAGAAATCTTCAAAACT
Locus tag: mlr4647
Name: PF00033 Funciton: cytochrome b561 |
||||
| PF00033 | -32 | 5.3 | AGCTTAGAAATCTTCAAAACT | mlr4647 |
| Xanthobacter autotrophicus Py2 | ||||
|
Position: -8
Score: 5.20256 Sequence: TTTTTAGAATGAATCAAAATA
Locus tag: Xaut_1186
Name: PF00033 Funciton: cytochrome b561 |
||||
| PF00033 | -8 | 5.2 | TTTTTAGAATGAATCAAAATA | Xaut_1186 |