Orthologous regulated operons containing modB gene

Properties
Regulog:	ModE - Various betaproteobacteria
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Proteobacteria/beta

Built upon 3 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Laribacter hongkongensis HLHK9
Position: -28 Score: 5.96967 Sequence: CGTTATATAGTCGTGTATATTACG Locus tag: LHK_02456 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE Locus tag: LHK_02457 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: LHK_02458 Name: modX Funciton: Predicted molibdenum binding protein Locus tag: LHK_02459 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: LHK_02460 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
modE-modA-modX-modB-modC	-28	6	CGTTATATAGTCGTGTATATTACG	LHK_02456

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --