Orthologous regulated operons containing hpd gene

Properties
Regulog:	TyrR1 - Alteromonadales
Regulator type:	Transcription factor
Regulator family:	TyrR
Regulation mode:	activator (repressor)
Biological process:	Aromatic amino acid metabolism
Effector:	Tyrosine; Phenylalanine
Phylum:	Proteobacteria/Gamma

Built upon 32 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Pseudoalteromonas atlantica T6c
Position: -195 Score: 4.64369 Sequence: CTGTAGCGTTAAGTTGACAA Position: -123 Score: 4.70919 Sequence: ATGTAAAGTTTATGTTACTT Locus tag: Patl_2997 Name: hpd Funciton: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
hpd	-195	4.6	CTGTAGCGTTAAGTTGACAA	Patl_2997
	-123	4.7	ATGTAAAGTTTATGTTACTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --