Orthologous regulated operons containing nadV gene
| Regulog: | NrtR - Cyanobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Cyanobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Synechocystis sp. PCC 6803 | ||||
|
Position: -69
Score: 6.01594 Sequence: TTTTGGTGAAATCTACTATAA
Locus tag: slr0787
Name: nadM Funciton: Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
Locus tag: slr0788
Name: nadV Funciton: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) |
||||
| nadM-nadV | -69 | 6 | TTTTGGTGAAATCTACTATAA | slr0787 |